1	Genetics
2	"Deoxyribonucleic acid (DNA)" Deoxyribonucleic acid (DNA) is made of a sequence of four nucleotides (ATCG) in a double strand.
3	What does DNA do? DNA carries our genetic code in the nucleotide sequence. Example: ATCGACGGCAATATACGGGCCATACGTATCACGTCAACCGT
4	"There are three billion base..." There are three billion base pairs in the DNA of every human cell. A – T G – C T – A C – G
5	What is a gene? A gene is a section of DNA sequence carrying a full set of instructions for a particular protein or trait. For every trait, you have a pair of genes.
6	What is an allele? An allele is an alternative form of a gene. Example: There is a gene pair that codes for height in a plant. One allele codes for tallness and one allele codes for shortness.
7	"We have two alleles for..." We have two alleles for every trait that reside on paired chromosomes.
8	"Dominant allele:" Dominant allele: an allele that expresses or shows its trait whenever it is present. IF YOU POSSESS IT, YOU WILL EXPRESS IT!
9	"Recessive allele:" Recessive allele: an allele that expresses or shows its trait only when two of them are present.
10	Examples: D = dark hair d = light hair Therefore: DD = dark hair Dd = dark hair dd = light hair
11	"Questions:" Questions: Does dominant mean better? Is “dominant” represented more in a population? Does “dominant” mean you will survive better?
12	"All “dominant”" All “dominant” means is that, if you have it, it will show up! It’s not necessarily better! Example: Huntington’s Disease
13	Genotype vs Phenotype Genotype: actual alleles someone has If a person has dark hair, then they have a genotype of DD or Dd If a person has light hair, they have a genotype of dd
14	"Phenotype:" Phenotype: The actual physical trait that is expressed If a person’s genotype is DD or Dd, then their phenotype is dark hair. If a person’s genotype is dd, then their phenotype is light hair.
15	There are three possible genotypes: DD homozygous dominant Dd heterozygous dominant dd homozygous recessive “hetero” means different “homo” means the same
16	What is a gene pool? All the genes (or alleles) in a population If we have 30 people in here, how many alleles do we have?
17	"If we have 30 people" If we have 30 people, we have 60 alleles for every trait. A dominant allele controls tongue rolling (T). How many can roll their tongues? (TT) or (Tt) How many cannot roll their tongues? (tt)
18	"Every trait has a gene..." Every trait has a gene pool in a population! If 10 are TT, 15 are Tt, and 5 are tt, then there are: T = 35 alleles t = 25 alleles 60 alleles total
19	"allele frequency:" allele frequency: percentage of any specific allele in the gene pool For tongue rolling: 35/60 X 100 = 58.3% for T 25/60 X 100 = 41.7% for t
20	"What is a gene?" What is a gene? DNA sequence that carries the genetic code for a specific protein or trait
21	What is an allele? An allele is a form or variation of a gene.
22	How many DNA base pairs are there in every human cell? There are 3,000,000,000 base pairs
23	What is the difference between a dominant and a recessive allele? If present, a dominant allele always expresses its trait. A recessive allele needs two to express.
24	What is a mutation? A mistake in the DNA sequence
25	"Every time a cell divides" Every time a cell divides, 3 mistakes are made in the DNA sequence. If you only got three wrong on a 3 billion question test, you’d probably get an A!
26	"Most mutations have no effect..." Most mutations have no effect on the codes! A very small % are bad for the genes (example: cancer cells) An even smaller % are good for the genes. (example: an altered protein to digest cellulose)
27	"What determines if a mutation..." What determines if a mutation is good or bad? Natural Selection!